Preparation of electrocompetent, recombination-induced

EL250 or EL350  cells

(Doug Mortlock version 1.0;  01/27/04)

 

EL250 and EL350 cells both have heat-inducible expression of recombination proteins.

Therefore always culture these cells at 32š or lower except at the brief induction step.

EL250 and EL350 cells also have arabinose-inducible FLP or CRE, respectively.

 

1. Inoc. miniculture with a fresh colony the afternoon before; shake @ 32š

 

2. Next day, inoc. a 20 ml LB culture (with antibiotic to retain the BAC to be modified) with 0.4 ml of the miniculture.

 Shake @ 32š until OD (A600) is about 0.4 (mid-log phase; note OD's vary with different specs.)

 

3. Transfer cultures immediately to 43š shaker water bath, for 20 minutes at 200 rpm to induce expression of recombination proteins.

***(OMIT THIS STEP to generate electrocompetent recombination- deficient cells, if just transferring plasmids/BACs into cells without requiring recombination.)

 

4. Incubate cultures on ice 20 min.  (following steps on ice)

 

5. Transfer to prechilled 50 ml tubes and spin down culture (i.e. Beckman JA10 rotor, 5000 rpm 10 min)

 

6. Remove sup.  Resusp in a total volume of 3 ml with clean, sterile millipore water. Aliquot to 2 epp tubes on ice.

 

7. Spin down in cold room 5'.  Rinse each pellet twice more, with 1.5 ml sterile water.

 

8. Resusp. with about 35 ul 10% glycerol.  Use for one electroporation immediately or freeze and store at -80š until use.

 

The above was derived from E-Chiang Lee et al. (Neal Copeland lab) Genomics 73, 56­65 (2001).

 

Doug Mortlock 2001

 


 

PCR amplification of TetR cassette for homologous recombination into EL250 cells

 

Useful for deleting sequences from BAC clones.

 

Either of two template plasmids is used: pFRT-Tet #17 for amplifying the Tet-R cassette flanked by FRT sites, or pTetBH2.4 #5 for Tet-R without FRT sites.  The product is about 2.4 kb.  The TetR cassette was cloned by PCR from the pSV1-RecA plasmid (Yang et al Nat. Biotech. 1997).  It originally came from the E.coli R100 episome.

 

To make a TetR cassette fragment with ends suitable for homologous recombination, use PCR primers that have either of your 50-base homology sequences as the first 50 bases at the 5' end, with the remaining 3' bases one of the following:

 

For pFRT-Tet #17: these primers are long since the FRT sites are embedded; this is the way to make modifications with the minimal sequence left behind, that is, a single FRT site only (34 bp). Shorter oligos can be made to anneal to the template plasmid just outside the FRT sites; this will however leave the annealing sequences within the modification.

 

FRT-tet-for (a.k.a FRT-tet-Ftest):

GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCAGATCTATGATTCCCT

 

FRT-tet-rev (a.k.a. FRT-tet-Rtest):

GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCAAGCTTATGATGATGA

 

For pTetBH2.4 #5 (no FRT sites):

 

tn10-tetR-F1:

AGATCTATGATTCCCTTTGTCAACAG

 

tn10-tetR-R1:

AAGCTTATGATGATGATGTGCTTAAAAAC

 

1. PCR: Use 0.1-1 ng supercoiled plasmid per 50 µl reaction. Typically I set up 8 reactions per primer pair.

 

 Program FRT-TET, hot room "old" cycler:

94š 3 min. initial denature

then 30 cycles of: (94š 30 sec / 55š 30 sec / 72š 2 min.)

finish: 5 min. 72š

 

2. Combine the reactions and run 5 µl on gel to check yield and quality of product.

 

3. Phenol/chloroform extract once

 

4. Chloroform-extract once.

 

5. Add 40µl sodium acetate pH5.2 + 1 ml ethanol.  Incubate at -20š 1 hour to precipitate.

 

6. DpnI digest:  If the template plasmid was grown in DH10B or another dam methylase+  strain, it can be destroyed by DpnI which cleaves methylated DNA while leaving unmethylated DNA (the PCR product) completely intact, thus reducing the background of Tet-resistant colonies after transformation.

            Spin down the precipitate from previous step and resuspend in:

                        16 µl H20

                        2 µl NEB 10x buffer #4

                        1 µl 10x BSA

            Add 1 µl DpnI and incubate at least 1 hour.

 

7. Repeat steps 4-6

 

8. Resuspend in 10 µl H20 and quantitate by running 1 µl and 5 µl of 1:20 dilution on a gel alongside quantitation standards.  The DNA can be used directly for transformation into recombination-competent cells.

 

 

 


 

Transformation to obtain BAC clones by homologous recombination

 

I use this protocol for integrating Tetracycline-resistance cassettes with flanking homology arms designed from the appropriate target sequences.  The protocol should work fine for other types of selection (i.e. kanamycin).

 

1. Make large LB plates with 6.25 µg/ml chloramphenicol (CAM) and 5 µg/ml tetracycline (TET). Two large plates are sufficient for plating one transformation.  Fresh plates work best. Tet plates should be stored wrapped in foil at 4š.

 

Transformation:

2.  Thaw a tube (or use a freshly made aliquot) on ice of heat-induced EL250 cells carrying the BAC to be targeted.

3. Add about 300 ng of the TetR-cassette DNA fragment in H20 (I suggest less than 5 µl total volume)

4. Electroporate

5. Immediately add 0.95 mls SOC

6. Incubate at 32š for 90 minutes with shaking, 250 rpm.

7. Plate 500 µl per large LB+CAM/TET plate. Incubate at 32š 1-2 days.

 

Under these conditions colonies usually become visible about 24 hours after plating at 32š and may be just big enough to pick. By 40 hours, true transformants should be obvious.  Note that by the third day, spontaneous Tet-R mutants begin to arise (i.e. if no obvious colonies grew by 48 hours, any that grow after that are probably not worth picking).

 

Deleting FRT-flanked TetR cassette by FLPe induction

 

The EL250 strain harbors an endogenous L-arabinose-inducible FLPe gene.

 

1. Inoculate several minicultures  (LB with CAM only, no Tet) each with an isolated TetR colony from the original TetR transformation, 32š for overnight shaking.  It is good to try more than one isolate, since occasional mutations/errors in the TetR-cassette PCR primers may have screwed up an FRT sequence in individual transformants.

2. The next day, inoculate 0.5 ml each miniculture into 20 mls LB+CAM.  Shake at 32š until A600 ~ 0.4 (2-3 hours).

3. Add 0.2 mls of sterile 10% L-arabinose. Continue shaking at 32š, 1 hour.

4. Remove all but 1 ml of the culture.  Add 9 mls LB+CAM. Continue shaking at 32š, 1 hour.

5. Dilute culture and spread on LB+ CAM plates.  Incubate overnight at 32š.  (100 µl of a 10-5 dilution should result in ~200 colonies.)

6. Pick about 10 colonies onto both LB+ CAM+TET and LB+ CAM-only plates to identify Tet-sensitive clones. Usually most  are Tet-S.

 


 

Inserting sequences by TetR-replacement strategy

 

This is a variation on the Yang et al. (Nature Biotech 1997) technique, using fusaric acid selection for tetracycline-sensitive clones after replacing the TetR cassette with a sequence of interest through homologous recombination.

 

There is a substantial background of spontaneous Tet-sensitive clones (~2.5 x 10-5) but the targeting frequency (using 50-base homology arms) allows the desired targeted clones to be isolated at a reasonable rate.

 

Media required: see below.

 

Part 1:  Using the above methods, create a BAC clone that has a TetR cassette (without FRT sites,  i.e. derived from pTetBH2.4 #5) inserted precisely at the desired modification site.

 

Part 2:

1. Using PCR, create a targeting fragment that contains the sequence you wish to insert flanked by the same homology arms used to insert the TetR cassette.  Prepare as described above.

2. Prepare recombinase-induced electrocompetent cells harboring the TetR BAC (make enough for at least 2 transformations, 1 with DNA and one control).

3. Electroporate one aliqout of the induced TetR-BAC cells with ~300 ng of the targeting fragment. Electroporate a separate aliquot of cells with the same volume of H20.  After the 90 minute incubation at 32š, plate all of the cells on a total of 2 LB+CAM+Chlorotetracycline plates (~500 µl per plate).  Incubate at room temp overnight.

4.  24 hours later a faint lawn should be visible.  Using a bent pasteur pipette, scrape all the cells from the 2 plates into 1 ml LB.  Repeat for the control transformation into a separate tube.  Spin down the cells and remove the excess liquid.

5. Resuspend the cell pellet in LB so the total volume is about 1.0 ml.  Plate out dilutions on LB+CAM+FUS plates (100 µl of a 10-3 dilution should yield about 1-300 colonies).  Also, plate out 100µl of a 10-7 dilution on LB+CAM-only, to estimate titre of all viable cells.  Incubate at 32š for 2 days. 

6. By the second day, Tet-S colonies should be clearly visible on the LB+CAM+FUS plates.  Pick for screening.


Media required for fusaric acid selection:

 

Chlorotetracycline + Chloramphenicol (CAM + chlorotetracycline) plates:

Without fusaric acid.  Make LB plate media, but before autoclaving add 8 ml of chlorotetracycline stock (6.3 mg/ml in 50% ethanol; and see below) per liter.

 

Chlorotet + Chloramphenicol + Fusaric Acid (Chlorotet+ CAM+FUS) Plates: 1 liter (~ 2 sleeves plates) Doug Mortlock 2001.  From Yang et at (RecA recombination Nature Biotech. 1997) and Bochner et al, J.Bac. 143:926-933 (1980)

 

                                                                                    1 liter              500ml

 

Bacto-Agar                                                                  18 g                 9g

Tryptone                                                                      10 g                 5g

Yeast extract                                                                5 g                   2.5g

Sodium Chloride                                                         10 g                 5g

glucose                                                                        2 g                   1g

NaH2PO4€H20                                                           10 g                 5g

Chlorotetracycline                                                       0.05g               0.025g                                    

Autoclave 20 min.  (Autoclaving denatures the chlorotetracycline, making it nontoxic but still can induce tetracycline resistance gene expression.)  Cool to 55š and add:

 

Fusaric Acid (2 mg/ml) **                                          6 ml

Zinc Chloride (20 mM)                                               5 ml

Antiobiotics as needed (i.e. chloramphenicol at 6.25 µg /ml)

 

Pour, let sit overnight, and store at 4š. Does not need to be kept dark.

Fusaric acid plates should be used within 2-3 weeks.

 

* 6.3 mg/ml of chlorotetracycline hydrochloride in 50% ethanol, store at -20š

** 2 mg/ml of fusaric acid (Sigma) in 100% ethanol, store at -20š.  This stock does not keep more than a few weeks.  The solid stock should also be stored at -20š.

 

Notes:

Always streak known tet-R and tet-S control strains on new plates to confirm the new plates work.   The fusaric acid stock must be fresh and the plates used within a week or two after pouring. Tet-R cells tend to revert to tet-S at reasonably high frequency, so some colonies will still usually grow from a "tet-R" streak.

Mechanism: Fusaric acid was identified empirically to inhibit cells expressing the tn10 tet-R phenotype, therefore chlorotetracycline is also added to induce tetR gene expression (see above).  Sodium phosphate buffers pH to 5.5 and adds sodium which both maximize selection.  Zinc reduces toxicity of fusaric acid to tet-S cells.  The Yang et.al. protocol has a recipe with not much yeast extract - I changed it back to the standard LB formula which gives faster growth.

 

Screening and verifying modifications

 

To verify inserted TetR cassettes:

 

1. PCR using a primer within TetR cassette and a primer sequence from the targeted region adjacent to the insertion site.  I have used the Tet-R1 primer (5'-GGAAGGAACGTCAATTCCCA) which is designed from the reverse strand of the TetR cassette; a PCR with this primer + a primer adjacent to the targeted site will amplify 141 bases (107 of tetR cassette + 34 of an FRT site) plus the distance from the FRT site through the adjacent primer.

2. Gel analysis: the TetR cassette has one MluI and one NruI site, useful for PFGE.

 

To verify deleted TetR cassettes:

 

1. PCR across the single remaining FRT site.  Purify and sequence directly off product from both directions to confirm.

2. Gel analysis: should have deleted the MluI and NruI sites of TetR cassette

 

Finally, one should do fingerprint digests (i.e. BamHI or HindIII) of the final putative modified BACs and compare these to the original BAC to check for unwanted rearrangements.  This should be done each time a new prep is made for microinjection.

 

Note that modified BACs do not have to be transferred out of the EL250 strain to prep for microinjection.  The recombinase proteins are strongly repressed at 32š and so unwanted rearrangenments are rare.  However, fingerprinting is still strongly advised.

 

Doug Mortlock, April 2001