Overgo screening of BAC library

(Craig, Pam, Mike; version 1.0;  Feb 2004)

 

Overgos are a pair of oligonucleotides with complementary  3š ends used to make radioactively labeled probes for screening filters by hybridization.

 

Information on stickleback CHORI filters is available at:

http://bacpac.chori.org/threesp213.htm

 

Design overgoes using Overgo Maker:

http://www.genome.wustl.edu/tools/?overgo=1

 

Comments on Overgo design:

We typically isolate stickleback sequence initially by degenerate PCR and RT-PCR using alignments including pufferfish and zebrafish sequences. This gene specific sequence we then input into Overgo Maker. Wešve also successfully isolated BACs by designing Overgos to highly conserved regions without isolating stickleback sequence first.

 

We recommend BLASTing the suggested Overgo sequences to the pufferfish and zebrafish genome assemblies to assure sequences are not repeat elements (e.g. MER repeats). We also recommend avoiding any homopolymer or repetitive stretches. Sometimes Overgo Maker can recommend an overgo with homopolymer stretches greater than three or containing di- or trinucleotide repeats. In these cases we trim this sequence from the input field and select a different target sequence.

 

Follow the CHORI protocol for hybridization:

(http://bacpac.chori.org/overgohyb.htm)

 

Hybridization of Overgos to BAC filters         

 

This original protocol was developed by Dr John D. Mc Pherson (Washington University School of Medicine, Genome Sequencing Center)

 

Reagents

 

Hybridization solution

1 mM EDTA

7% SDS

0.5M sodium phosphate (pH7.2)

 

1M sodium phosphate, pH 7.2:

426 g sodium phosphate dibasic, anhydrous (Na2HPO4) in 1700 ml H2O, add 12 ml 85% H3PO4 and make to 3 liter

 

0.5M EDTA, pH 8.0:

200 g EDTA - 4Na and 176.44 g EDTA - 2Na in 1,600 ml H2O, pH to 8.0 with NaOH pellet and make to 2 liter.

 

To make 4000 ml: (use sterile ddH2O)

 

1. To 2000 ml 1M sodium phosphate, add 1200 ml H2O, 8ml 0.5M EDTA and 280 g SDS.

2. Heat and stir until the SDS is dissolved (1 hr or so).

3. Bring volume to 4000 ml.

4. Warm to 60 C prior to use.

 

Washing Buffer B:

 

1mM EDTA, 1 % SDS, 40mM Na2HPO4

12 ml 0.5 M EDTA

60 g SDS

240 ml 1M Na2HPO4, pH7.2

to 6L with ddH2O

 

Washing solution 2:

 

1.5x SSC, 0.1% SDS

375 ml 20x SSC

25 ml 20% SDS

to 5L with ddH2O

 

Washing solution 3:

 

0.5x SSC, 0.1% SDS

125 ml 20x SSC

25 ml 20% SDS

to 5L with ddH2O

 

20x SSC:

701.2 g NaCl

352.8 g sodium citrate, dihydrate

pH to 7.0 with a few drop of a conc. HCl

Bring volume to 4L with ddH2O

 

20% SDS: 400g SDS (Ultra Pure: Life Technologies)/2L ddH2O

 

BSA (2 mg/ml) : diluted 10ml/ml BSA (purchased from New England Biolabs) with ddH2O prior to use

 

Overgo labeling buffer: OLB {-dATP, -dCTP}

 

Solution O: 1.25 M Tris-HCl, pH 8.0, 125 mM MgCl2

625 ul 2 M Tris-HCl (pH8.0)

125 ul 1 M MgCl2

250 ul ddH2O

 

Solution A: 1 ml solution O

18 ul 2-mercaptoethanol

5 ul 100 mM dTTP                            (Amersham 27-2080-01)

5 ul 100 mM dGTP                            (Amersham 27-2070-01)

 

Solution B: 2 M HEPES-NaOH, pH 6.6

Dissolve 23.8g of HEPES-free acid (m.w. 238.3; SIGMA H-4034) in 40ml de-ionized distilled water and adjust the pH to 6.6 with NaOH. Adjust the final volume to 50 ml with deionized distilled water.

 

Solution C: 3 mM Tris-HCl, pH 7.4, 0.2mM EDTA

15 ul 1 M Tris-HCl (pH7.4)

2 ul 0.5 M EDTA

to 5 ml with ddH2O

 

Prepare OLB: A:B:C, 1:2.5:1.5

 

Solution A 1ml

Solution B 2.5ml

Solution C 1.5ml

 

Aliquot and store at -20 C.

 

Overgo Labeling Reaction: 10 ul reaction

 

1) Combine 0.5 ul of complementary 20 uM oligos (0.5 + 0.5) with 4.5 ul ddH2O.

{10 pmol each oligo per reaction}. Donšt forget the anchor spots! (see below)

 

2) Heat solution of mixed oligos at 80 C, 5 min., 37 C, 10 min. Store on ice.

 

3) Add to the oligo mix:

 

BSA (2 mg/ml):     0.5 ul

OLB {-A, -C}      2.0 ul

32P-dATP*          0.5 ul                                           *3000 Ci/mmol, 10 mCi/ml

32P-dCTP*          0.5 ul

Klenow fragment 1 ul (2U/ul)

 

4) Incubate at room temperature for 1 hour.

 

5) Remove unincorporated nucleotides with Sephadex G50 columns.

 

Hybridization of Overgos to BAC filters

 

1) Filters are stacked 4-6 high, (DNA side up) interleaved with nylon spacers of equal size, in a plastic tray soaked with hybridization solution. Press out air bubbles and loosely roll the filters. Insert the rolled filters into a hybridization bottle the same way for all bottles. Remove air bubbles from the filters using a 25 ml pipette, making sure filters are flat. Add 25 ml of warmed hybridization solution to each bottle. Make sure that all filters are rolled in the same direction and that the bottle is correctly placed in the oven to keep them rolled. The rotation speed is set to 6.

(To maintain correct orientation and prevent filters from tightly winding during rotation, roll filters away from you. Hold filters in right hand, place into bottle in left hand. Place in oven with bottle cap to the left).

 

2) Filters are pre-hybridized for 1 hour. Replace hybridization solution before adding probes if filter is used for the first time.

 

3) After filter pre-hybridization, heat the labeled probes at 95 C on hot block for 10 min. Then immediately place probes on slushy ice and add to appropriate hybridization bottle. Probes are allowed to hybridize with filters overnight; however, 2-day hybridizations give somewhat stronger signals, especially with older filters.

 

Washing: Preheat all wash solutions to 60 C

 

1) Hybridization solution is removed and the bottle filled with 100 ml 1x washing buffer B. The bottle is returned to the oven at 60 C and rotated for 30 minutes, speed 8.

 

2) Filters are then washed as follows in hybridization oven, speed 8: (100 ml wash).

 

2x Washing solution 2 at 60 C for 20min

 

3) Filters are washed in the hybridization oven for 20 minutes at 60 C with 100 ml wash solution 3, rotating speed 8.

 

4) Soak filters in hybridization solution.

 

Phospho-Imaging:

 

1) Place filters in plastic bags and remove all air bubbles. Seal and check for leaks. Wipe outside of bag with wet kimwipe to remove any hybridization solution.

 

2) Place filters in a phosphoimage cassette for overnight exposure. Scan image into Storm Phosphoimager using: template = filter, pixel = 200 um. (8 minutes to scan image). See Figure 1 for an example.

 

3) After image capture, filters are stored at -20 C in the sealed plastic bag or in hybridization buffer in a plastic bag at room temperature for a long-term storage.

------------------------------------------------------------------------

 

References:

 

McPherson JD, Marra M, Hillier L, Waterston RH, Chinwalla A, Wallis J, Sekhon M, Wylie K, Mardis ER, Wilson RK, Fulton R, Kucaba TA, Wagner-McPherson C, Barbazuk WB, Gregory SG, Humphray SJ, French L, Evans RS, Bethel G, Whittaker A, Holden JL, McCann OT, Dunham A, Soderlund C, Scott CE, Bentley DR, Schuler G, Chen HC, Jang W, Green ED, Idol JR, Maduro VV, Montgomery KT, Lee E, Miller A, Emerling S, Kucherlapati, Gibbs R, Scherer S, Gorrell JH, Sodergren E, Clerc-Blankenburg K, Tabor P, Naylor S, Garcia D, de Jong PJ, Catanese JJ, Nowak N, Osoegawa K, Qin S, Rowen L, Madan A, Dors M, Hood L, Trask B, Friedman C, Massa H, Cheung VG, Kirsch IR, Reid T, Yonescu R, Weissenbach J, Bruls T, Heilig R, Branscomb E, Olsen A, Doggett N, Cheng JF, Hawkins T, Myers RM, Shang J, Ramirez L, Schmutz J, Velasquez O, Dixon K, Stone NE, Cox DR, Haussler D, Kent WJ, Furey T, Rogic S, Kennedy S, Jones S, Rosenthal A, Wen G, Schilhabel M, Gloeckner G, Nyakatura G, Siebert R, Schlegelberger B, Korenberg J, Chen XN, Fujiyama A, Hattori M, Toyoda A, Yada T, Park HS, Sakaki Y, Shimizu N, Asakawa S, Kawasaki K, Sasaki T, Shintani A, Shimizu A, Shibuya K, Kudoh J, Minoshima S, Ramser J, Seranski P, Hoff C, Poustka A, Reinhardt R, Lehrach H. A physical map of the human genome. The International Human Genome Mapping Consortium. Nature. 2001 Feb 15;409(6822):934-41.

 

Ross M.T., LaBrie, S., Mc Pherson, J. & Stanton, V.P. In Current Protocols in Human Genetics (eds Dracopoli,m N. C. et al.) 5.6.1-5.6.5 (Wiley, New York, 1999)

 

Notes/comments on CHORI protocol:

 

Recipes for making solutions (these amounts are enough for one BAC screen of 4 bottles, use sterile milliQ water for all):

 

1 L of 1M sodium phosphate buffer, pH 7.2

mix:

142 g Na2HPO4 (sodium phosphate dibasic)

567 ml H2O

4 ml 85% H3PO4 (phosphoric acid)

bring up to 1 L total volume with H2O

 

400 ml hybridization solution

800 uL 0.5 M EDTA, (ours is premade and pH 8.0, using this works fine)

200 ml 1 M sodium phosphate buffer, pH 7.2

140 ml 20% SDS

to 400 ml total volume with H2O

 

500 ml wash buffer B

1 ml 0.5 M EDTA, pH 8.0

20 ml 1 M Na2HPO4, pH 7.2

25 ml 20% SDS

to 500 ml with H20

 

500 ml wash buffer 2 (make 2 500 ml bottles of this)

37.5 ml 20 X SSC

2.5 ml 20% SDS

to 500 ml with H2O

 

500 ml wash buffer 3

12.5 ml 20 X SSC

2.5 ml 20% SDS

to 500 ml with H20

-                                  

other notes/comments:

 

-Donšt forget to add anchor spot overgoes!

details are available at: http://bacpac.chori.org/anchors.htm; anchor spot overgo sequences are:

RPCI941a1-OVF            GTTGCCAAATTCCGAGATCTTGGC

RPCI941a1-OVR            ATCATGTGGCTTCGTCGCCAAGAT

 

-OLB (overgo labeling buffer) should be less than a year old

 

- We typically combine 3 pairs of Overgoes along with the anchor spot pair of Overgoes into one 12 inch bottle containing 4 stacked filters (all DNA side up!) separated by nylon filters.

 

-Dispose of first two washes in hot liquid waste!

 

-Wrap each filter in saran wrap when washes are done. Carefully roll all bubbles out of wrapped filter with 25 ml pipette. Tape two filters onto used piece of film to support in film exposure cassette. This causes small areas of overlap at one corner of each filter but this is not a problem. Remember to tape fluorescent rulers onto each used piece of film (away from filters) as control signal for autorad. If these are taped on at different angles for each piece of used film, one can uniquely identify each pair of filters after the exposure. Remember to expose these rulers to bright light beforehand so they will fluoresce.

 

-If youšve combined multiple overgoes, determine which spots correspond to each probe by PCR screening colonies. First determine how many ICE (internet contig explorer) contigs are present in each bottle. Usually many BACs from the filter screen fall into a smaller number of ICE contigs. PCR screening representative BACs from each contig then can greatly facilitate figuring out which spots corrrespond to which probes.

(stickleback ICE info is at: http://cegs.stanford.edu/Physical_map.jsp)